FseI from New England Biolabs

Product Specs
ItemFseI
CompanyNew England Biolabs
Price Pricing Info Supplier Page View Company Product Page
Catalog NumberR0588L
Concentration2 u/µL
Quantity500 units
ApplicationsDNA Manipulation
Brand/TrademarkNew England Biolabs Inc (NEB)
TypeRestriction Enzyme
Temperature-80 C

Sequence

GGCCGG/CC

Add to Compare List

New England Biolabs

240 County Road

Ipswich, Massachusetts 1938

United States

Phone: 800-632-5227
800-632-7799
978-921-1350

Company Profile

Website: http://www.neb.com

(1) Efficient Formation of Single-copy Human Artificial ChromosomesbioRxivJuly 7, 2023Craig W. Gambogi, Elie Mer, David M. Brown, George Yankson, Janardan N. Gavade, Glennis A. Logsdon, Patrick Heun, John I. Glass, Ben E. Blackagarose plugs by resuspending 5 × 106 cells/ml in 0.8% agarose and digested overnight with Fse1 (NEB; R0588L) at 37 °C. Digested DNA was separated via CHEF electrophoresis (Bio-Rad, CHEF DR II System) at 3 V/Cm,

(2) Domains required for the interaction of the central negative element FRQ with its transcriptional activator WCC within the core circadian clock of NeurosporaJournal of Biological ChemistryJuly 1, 2023Bin Wang, Jay C. Dunlap(5′-CAGCACATGTTCAACTTCATCAC-3′) were designed for pCB05 digested with NruI (NEB, Catalog # R0192S) and FseI (NEB, Catalog # R0588S) (FRQ aa 438–675), and “frq segment 4F” (5′-CACCGATCTTTCAGGAGACCCTG-3′) and “frq segment 4R” (5′-CACTCAGGTC

(3) A self‐propagating, barcoded transposon system for the dynamic rewiring of genomic networksMolecular Systems BiologyJune 12, 2023Max A English, Miguel A Alcantar, James J Collins,New England Biolabs,M0494L BbsI‐HF,New England Biolabs,R3539L BsmBI‐v2,New England Biolabs,R0739L FseI,New England Biolabs,R0588L SbfI‐HF,New England Biolabs,R3642L T4 DNA Ligase,New England Biolabs,M0202L Carbenicillin disodium salt

(4) Comparison of the structure-function properties of wild-type human apoA-V and a C-terminal truncation associated with elevated plasma triglyceridesmedRxivFebruary 26, 2023Sylvia Stankov, Cecilia Vitali, Joseph Park, David Nguyen, Leland Mayne, S. Walter Englander, Michael G. Regeneron Genetics Center, Michael G. Vujkovic, Nicholas J. Vujkovic, Nicholas J. Phillips, et al.5’-AATAATGGCCGGCCCGGACCCCTAGATGCTCTCCGAGGAGGTGCGCCAGCGACTTCAGGCTTTCCGCCAGGACACCTACCTGCAGATAGCTGCCTTCACTCGCGCCATCGACCAGGAGACTGAGGAGGTCCAGCAGCAGCTGGCGCCACCTCCACCAGGCCACAGTGCCTTCGCCCCAGAGTTTCAACAAACAGACAGTGGCAAGGTTCTGAGCAAGCTGCAGGCCCGTCTGGATGACCTGTGGGAAGACATCACTCACAGCCTTCATGACCAGGGCCACAGCCATCTGGGGGACCCCTGATAATGAATTCCATATAT-3’ was digested with FseI (NEB, R0588S) and EcoRI-HF then purified (QIAquick PCR Purification Kit, 28104). This fragment was sub-cloned into

(5) Macrophage NFATC2 mediates angiogenic signaling during mycobacterial infectionCell reportsDecember 13, 2022Brewer WJ, Xet-Mull AM, Yu A, Sweeney MI, Walton EM, Tobin DM.R0145L DpnI,NEB,Cat# R0176L XmaI,NEB,Cat# R0180L PfIMI,NEB,Cat# R0509L MwoI,NEB,Cat# R0573L FseI,NEB,Cat# R0588L NotI,NEB,Cat# R3189L Total RNA Cleanup Kit,NEB,Cat# T2010S RNA Cleanup Kit (50 μg),NEB,Cat# T2040L 6.5mm

(6) The nematode Oscheius tipulae as a genetic model for programmed DNA eliminationCurrent BiologyDecember 1, 2022Thomas C. Dockendorff, Brandon Estrem, Jordan Reed, James R. Simmons, Sobhan Bahrami Zadegan, Maxim V. Zagoskin, Vincent Terta, Eduardo Villalobos, Erin M. Seaberry, Jianbin Wangplugs were digested with the restriction enzyme AsiSI (NEB, catalog # R0630) or FseI (NEB, catalog # R0588) to generate DSBs as an internal control. DSBs were blunted with exonuclease VII (NEB, catalog # R0630)

(7) Osteoclast-mediated resorption primes the skeleton for successful integration during axolotl limb regenerationeLifeOctober 11, 2022Camilo Riquelme-GuzmÃ¡n, Stephanie L Tsai, Karen Carreon Paz, Congtin Nguyen, David Oriola, Maritta Schuez, Jan BruguÃ©s, Joshua D Currie, Tatiana Sandoval-GuzmÃ¡npromoter. For ligation, plasmid restriction was performed using the FseI and XhoI restriction enzymes (#R0588S, #R0146S, respectively; New England BioLabs, Frankfurt am Main, Germany). Fertilized embryos from d/d

(8) Genetic manipulation of gut microbes enables single-gene interrogation in a complex microbiomeCellFebruary 1, 2022Wen-Bing Jin, Ting-Ting Li, Da Huo, Sophia Qu, Xin V. Li, Mohammad Arifuzzaman, Svetlana F. Lima, Hui-Qing Shi, Aolin Wang, Gregory G. Putzel, et al.Concentrator,Zymo Research,Cat# D4003 Esp3I restriction enzyme,NEB,Cat# R0734S FseI restriction enzyme,NEB,Cat# R0588S Gibson Assembly Cloning Kit,NEB,Cat# E5510S GpC (M.CviPI) methyltransferases,NEB,Cat# M0227S Hemoccult

(9) Toxoplasma gondii GRA28 Is Required for Placenta-Specific Induction of the Regulatory Chemokine CCL22 in Human and MousemBioDecember 21, 2021Elizabeth N. Rudzki, Stephanie E. Ander, Rachel S. Coombs, Hisham S. Alrubaye, Leah F. Cabo, Matthew L. Blank, Nicolás Gutiérrez-Melo, J. P. Dubey, Carolyn B. Coyne, Jon P. Boylewith two restriction enzyme sites (sequence, GTTTAAACGGCCGGCC) for PseI (NEB R0560S) and FseI (NEB R0588S). This modified plasmid was then used as the template for all future Q5 reactions. Two unique gRNA sequences

(10) Precise CAG repeat contraction in a Huntington’s Disease mouse model is enabled by gene editing with SpCas9-NGCommunications BiologyDecember 1, 2021Seiya Oura, Taichi Noda, Naoko Morimura, Seiji Hitoshi, Hiroshi Nishimasu, Yoshitaka Nagai, Osamu Nureki, Masahito Ikawa#62988) with that of pX330-SpCas9-NG (Addgene plasmid #117919) using AgeI (R0552, NEB, MA, USA) and FseI (R0588, NEB) restriction enzymes. A DNA oligo (Genedesign, Osaka, Japan) was ligated into the BbsI (R0539,

(11) GEM-IL: A highly responsive fluorescent lactate indicatorCell Reports MethodsNovember 22, 2021Ramsey Bekdash, Jose R. Quejada, Shunnosuke Ueno, Fuun Kawano, Kumi Morikawa, Alison D. Klein, Kenji Matsumoto, Tetz C. Lee, Koki Nakanishi, Amy Chalan, et al.inserted into the Ai38 targeting construct (Addgene, #34883) utilizing the FseI restriction site (NEB, R0588S). The construct was then linearized using PvuI-HF digestion enzyme (NEB, R3150S). The linearized construct

(12) NAMPT reduction‐induced NAD ⁺ insufficiency contributes to the compromised oocyte quality from obese miceAging CellNovember 1, 2021Hengjie Wang, Shuai Zhu, Xinghan Wu, Yuan Liu, Juan Ge, Qiang Wang, Ling Gu5′‐GGGCTAGAGGCGCGCCCTAATGAGGTGCCA‐3′. Purified PCR products were digested with FseI and AscI (R0558S and R0588S, NEB), and then cloned into the pCS2+vector with Myc tags. For the synthesis of Nampt mRNA, the Nampt‐pCS2+

(13) A Tendon-Specific Double Reporter Transgenic Mouse Enables Tracking Cell Lineage and Functions Alteration In Vitro and In VivoInternational journal of molecular sciencesOctober 17, 2021Chen R, Zhou X, Skutella T.SalI (R0138S, New England Biolabs, MA, USA) and AscI (R0558S, New England Biolabs, MA, USA) + FseI (R0588S, New England Biolabs, MA, USA) separately, the col1a1-BFP and Scx-mScarlet transgenic constructs were

(14) Highly efficient manipulation of nervous system gene expression with NEPTUNECell Reports MethodsAugust 23, 2021Katrin Mangold, Jan Mašek, Jingyan He, Urban Lendahl, Elaine Fuchs, Emma R. AnderssonScientific,BP742 EcoRI-HF,NEB,R3101L SmaI,NEB,R0141S BamHI-HF,NEB,R3136L NheI,NEB,R3131S FseI,NEB,R0588S XmnI,NEB,R0194S SacII Enzyme,NEB,R0157 SphI-HF,NEB,R3182 NdeI,NEB,R0111S SalI-HF,NEB,R3138S CutSmart Buffer

(15) Analysis of Zika virus capsid-Aedes aegypti mosquito interactome reveals pro-viral host factors critical for establishing infectionNature communicationsMay 13, 2021Gestuveo RJ, Royle J, Donald CL, Lamont DJ, Hutchinson EC, Merits A, Kohl A, Varjak M.backbone. eGFP coding sequence was removed using restriction with XhoI and FseI (New England BioLabs, Cat# R0588S) in the presence of CIP. TER94 coding sequence was PCR amplified from reverse-transcribed total RNA

(16) An early cell shape transition drives evolutionary expansion of the human forebrainCellApril 15, 2021Benito-Kwiecinski S, Giandomenico SL, Sutcliffe M, Riis ES, Freire-Pritchett P, Kelava I, Wunderlich S, Martin U, Wray GA, McDole K, et al.The construct AAVS1-Puro-CAG-fl-STOP-fl-Cas9 was linearized with MluI (NEB, R3198S) and FseI (NEB, R0588S) to remove the Cas9 coding sequence, which was then replaced with the fragment encoding ZEB2-GFP-Flag-WPRE-poly(A)

(17) The genotype‐phenotype landscape of an allosteric proteinMolecular Systems BiologyMarch 30, 2021Drew S Tack, Peter D Tonner, Abe Pressman, Nathan D Olson, Sasha F Levy, Eugenia F Romantseva, Nina Alperovich, Olga Vasilyeva, David Rosslibrary with full length lacI CDS. Agarose gel purify the ligation product.Digest with FseI (NEB, cat. #R0588S). Agarose gel purify digested product.Circularize the linear product by ligating with T4 DNA ligase,

(18) Characterization of Metabolic Patterns in Mouse Oocytes during Meiotic MaturationMolecular cellNovember 5, 2020Li L, Zhu S, Shu W, Guo Y, Guan Y, Zeng J, Wang H, Han L, Zhang J, Liu X, et al.AM2141 AscI endonuclease,New England Biolabs,Cat# R0558S FseI endonuclease,New England Biolabs,Cat# R0588S T4 DNA ligase,New England Biolabs,Cat# M0202S NotI endonuclease,New England Biolabs,Cat# R0189S DpnI

(19) Cx43 and Associated Cell Signaling Pathways Regulate Tunneling Nanotubes in Breast Cancer CellsCancersSeptember 29, 2020Tishchenko A, Azorín DD, Vidal-Brime L, Muñoz MJ, Arenas PJ, Pearce C, Girao H, Ramón Y Cajal S, Aasen T.with FastDigest AgeI (Thermo Scientific; #ER1461, Waltham, MA, USA) and FseI (New England BioLabs; #R0588S, Hitchin, UK) in CutSmart® Buffer (New England Laboratories; #B7204S): the AgeI cut site is 1238 bp

(20) Cell Type-specific mRNA Purification in Caenorhabditis elegans via Translating Ribosome Affinity PurificationBIO-PROTOCOLAugust 5, 2019Ian G McLachlan, Steven W Flavellcatalog number: 122203) 14. FseI and AscI restriction enzymes (New England Biolabs, catalog numbers: R0588, R0558, respectively) 15. Liquid nitrogen 16. 1,2-diheptanoyl-sn-glycero-3-phosphocholine (DHPC; Avanti,

Be the First to Write a Review!

FseI

FseI from New England Biolabs

Sequence

New England Biolabs

Citations (28)

Reviews

FseI from New England Biolabs

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map